Question 214505

2.3) From this sense strand of DNA:

5’ATGCCGGGGTGATCTACGTAGATTGCAAAAATGA3’ give the complementary antisense DNA strand. Given that GAUCU and UUGCA are introns, give the modified mRNA strand to be transcribed from the sense strand and the protein sequence that will follow.

"Get 15% discount on your first 3 orders with us"
Use the following coupon
"FIRST15"

Order Now